Review



addgene pflag cmv herk1  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc addgene pflag cmv herk1
    Addgene Pflag Cmv Herk1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+herk1+plasmid/pFLAG-CMV-hErk1+(Plasmid+%2349328)/pmc12167936-139-10-10
    Average 93 stars, based on 14 article reviews
    addgene pflag cmv herk1 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Negative MAPK-ERK regulation sustains CIC-DUX4 oncoprotein expression in undifferentiated sarcoma
    Article Snippet: .. DUSP6 WT (27975) and delta DUSP6 (C293S) (27977) were gifts from Igor Astasturov and purchased from Addgene. pFLAG-CMV-hErk1 plasmid was a gift from Melanie Cobb (Addgene 49328), and ERK2-GFP was purchased from Genecopoeia (EX-A0354-M03). .. The Cas9 + sgCICDUX4 plasmid was a gift from William Hahn (Addgene 74959).



    Similar Products

    addgene pflag cmv herk1  (Addgene inc)
    93
    Addgene inc addgene pflag cmv herk1
    Addgene Pflag Cmv Herk1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+herk1+plasmid/pFLAG-CMV-hErk1+(Plasmid+%2349328)/pmc12167936-139-10-10
    Average 93 stars, based on 1 article reviews
    addgene pflag cmv herk1 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    addgene pflag 46 cmv herk1  (Addgene inc)
    93
    Addgene inc addgene pflag 46 cmv herk1
    Addgene Pflag 46 Cmv Herk1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+herk1+plasmid/pFLAG-CMV-hErk1+(Plasmid+%2349328)/10__1158_slash_0008___5472__can___24___0693-123-9-9
    Average 93 stars, based on 1 article reviews
    addgene pflag 46 cmv herk1 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    pflag cmv herk1  (Addgene inc)
    93
    Addgene inc pflag cmv herk1
    Pflag Cmv Herk1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+herk1+plasmid/pFLAG-CMV-hErk1+(Plasmid+%2349328)/pm37816856-60-10-18
    Average 93 stars, based on 1 article reviews
    pflag cmv herk1 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    mutagenesis pbabepuro ha mek1  (Addgene inc)
    93
    Addgene inc mutagenesis pbabepuro ha mek1
    Mutagenesis Pbabepuro Ha Mek1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+herk1+plasmid/pFLAG-CMV-hErk1+(Plasmid+%2349328)/pm37816856-60-4-18
    Average 93 stars, based on 1 article reviews
    mutagenesis pbabepuro ha mek1 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    mlypla2 50 caggtccttggcactgccattg 30 integrated dna technologies n a recombinant dna pflag cmv herk1 addgene rrid addgene 49328  (Addgene inc)
    93
    Addgene inc mlypla2 50 caggtccttggcactgccattg 30 integrated dna technologies n a recombinant dna pflag cmv herk1 addgene rrid addgene 49328
    Mlypla2 50 Caggtccttggcactgccattg 30 Integrated Dna Technologies N A Recombinant Dna Pflag Cmv Herk1 Addgene Rrid Addgene 49328, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+herk1+plasmid/pFLAG-CMV-hErk1+(Plasmid+%2349328)/pm37715953-184-199-208
    Average 93 stars, based on 1 article reviews
    mlypla2 50 caggtccttggcactgccattg 30 integrated dna technologies n a recombinant dna pflag cmv herk1 addgene rrid addgene 49328 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    pcdna3 cdk5gfp  (Addgene inc)
    93
    Addgene inc pcdna3 cdk5gfp
    Pcdna3 Cdk5gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+herk1+plasmid/pFLAG-CMV-hErk1+(Plasmid+%2349328)/pmc09258953-200-35-36
    Average 93 stars, based on 1 article reviews
    pcdna3 cdk5gfp - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    pbabepuro ha mek1  (Addgene inc)
    93
    Addgene inc pbabepuro ha mek1
    Pbabepuro Ha Mek1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pflag+cmv+herk1+plasmid/pFLAG-CMV-hErk1+(Plasmid+%2349328)/bio_rxiv__2022__06__27__497627-212-0-13
    Average 93 stars, based on 1 article reviews
    pbabepuro ha mek1 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results